• Users Online: 213
  • Print this page
  • Email this page

 Table of Contents  
Year : 2019  |  Volume : 3  |  Issue : 1  |  Page : 8-12

Molecular detection of human papillomavirus in cervical cancer patients

1 Department of Microbiology, Faculty of Science, Misurata University, Misurata, Libya
2 Biotechnology Research Centre, Misurata Cancer Centre, Misurata, Libya

Date of Web Publication26-Mar-2019

Correspondence Address:
Dr. Omar Alqawi
Biotechnology Research Centre, Misurata Cancer Centre, Misurata
Login to access the Email id

Source of Support: None, Conflict of Interest: None

DOI: 10.4103/LJMS.LJMS_40_18

Rights and Permissions

Background: Human papillomavirus (HPV) is a major etiological agent in cancers, especially cervical cancer. More than 96% of cervical cancer cases are positive for HPVs, especially high-risk types. The screening of HPV in cervical cancer patients will impact on the early diagnosis and prevention of the malignancy by a vaccine. Materials and Methods: The aim of the study is to detect HPV in Libyan cervical cancer patients aged between 34 and 80 years. The 38 formalin-fixed paraffin-embedded tissue samples of cervical cancer tumors were obtained from Misurata Cancer Center and Tripoli Medical Center. The DNA was extracted and used for polymerase chain reaction (PCR) analysis to detect HPV using specific primers. The clinical data of patients were collected and correlated with the presence of HPV. Results: Our data showed that 71% (27/38) of studied cases were infected with HPV. The presence of the virus was detected mainly in both squamous cell carcinoma (73%) and adenocarcinoma (33%) patients diagnosed with Grade III of cervical cancer. Conclusion: The infection with HPV is high in Libyan cervical cancer patients. The PCR is a promising molecular technique to detect HPV in cervical cancer. The molecular screening of the virus will improve the early diagnostics of the disease and test the efficacy of its prevention plan in the Libyan population.

Keywords: Adenocarcinoma, cervical cancer, human papillomavirus, polymerase chain reaction, squamous cell carcinoma

How to cite this article:
Alwash M, Altaweel M, Alqawi O. Molecular detection of human papillomavirus in cervical cancer patients. Libyan J Med Sci 2019;3:8-12

How to cite this URL:
Alwash M, Altaweel M, Alqawi O. Molecular detection of human papillomavirus in cervical cancer patients. Libyan J Med Sci [serial online] 2019 [cited 2020 May 29];3:8-12. Available from: http://www.ljmsonline.com/text.asp?2019/3/1/8/254955

  Introduction Top

Human papillomavirus (HPV) is considered as a major cause of cervical cancer.[1],[2] It stands as a most common risk factor associated with the disease.[3] Papillomaviruses comprise a large family of viruses; more than 300 papilloma viruses have been identified and completely sequenced including over 200 HPVs.[4] These adenoviruses have been extensively investigated for decades because of their ability to breakdown cellular mechanisms of growth control.[5]

HPVs were as first implicated in cancer biology by causing cervical cancer.[6] HPV belongs to papillomaviridae family which is nonenveloped, small double-stranded DNA virus with approximately 7900 base pairs.[7]

All HPV genomes include 3 general regions: upstream regulatory region, early region E with 6 open reading frames, and late region L with 2 open reading frames, that is coding for major and minor capsid protein. The three regions are separated by polyadenylation sites.[7],[8],[9]

The open reading frame of late capsid gene (major capsid protein L1) has been chosen as the standard for papillomavirus classification.[4] The types of HPVs that cause cervical cancer belong to the alpha group and are defined as high-risk HPV. The low risk of HPV from the same group is associated with benign warts.[10] The life cycle of genital HPV requires the availability of the basal epithelial cells of the mucosa of the an ogenital tract that are still able to proliferate.[11] Integration of high-risk HPV into the host cellular genome is considered as the important event in the pathogenesis of cervical cancer. It is related to the progression from premalignant to the invasive carcinoma.[12] Although cervical cancer is preventable and curable, most cases are presented at advanced stages. As a result, those cases need more extensive chemotherapy and radiation therapy. This situation is due to the lack of a proper screening program.[13] The screening tests for cervical cancer include the visual examination with acetic acid visual inspection with acetic acid and the  Pap smear More Details. The major problem of the two methods is the low sensitivity to detect high-grade precursor lesion, which requires frequent testing.[14] There are two new preventive approaches emerged over the last decades. First, the vaccination for the primary prevention of HPV infections, and the second is the early detection of infection with HPVs. The challenge lies in identifying the HPV infection of precancerous lesions and early-stage of cervical cancers.[15],[16] The detection of HPV may occur by nonmolecular techniques such as ELISA, which is not sufficiently sensitive or specific to be adequate for routine clinical diagnosis. The molecular techniques based on the hybridization of the target HPV DNA is an encouraging method to detect HPV with high sensitivity and specificity.[8] Due to the lack of data on HPV infection in cervical cancer patients in Libya, we investigated the presence of HPV in fixed cervical tumors by polymerase chain reaction (PCR). The obtained data were analyzed and correlated with the patient's clinical data such as the age and the stage of cervical tumors.

  Materials and Methods Top

Sample collection

The study was designed to investigate the HPV infection status in cervical cancer tissues collected from Misurata Cancer Center and Tripoli Medical Center. The formalin-fixed paraffin-embedded (FFPE) tissues were used to extract genomic DNA which is analyzed by PCR for HPV detection. The obtained data on the HPV infection is correlated with the clinical information of the cervical cancer patients.

A total of 38 (hysterectomy and biopsy) FFPE samples of cervical cancer tissues were collected during 2010–2015. The tissue samples were taken from cervical cancer patients aged from 34 to 80 years with median of 51 years. The stages of the cervical cancer tumors were examined by the Department of Histopathology at Misurata Cancer Center. The stages were ranged between IA and II B according to the International Federation of Gynecology. Thirty-four of the samples were tissues of squamous cell carcinoma, 3 samples were adenocarcinoma, and one was severe dysplasia of the cervix. The medical reports obtained from histopathology departments have shown that most of the samples were in Grade III. Five samples of cervical tissues from healthy women were tested as a control group of this study.

DNA extraction

DNA was extracted from few sections of FFPE cervical tissues using the QIA amp DSA DNA FFPE Tissue kit (Qiagen, Germany) according to the manufacturer's instructions. DNA samples were electrophoresed on 1% agarose gel prepared in 1X TAE buffer (Tris base, Acetic acid, and EDTA) to check their integrity and staining with ethidium bromide. DNA was visualized under UV light using Multidoc-It digital imaging system (UVP Company).

Detection of human papillomavirus

DNA from each sample was amplified by PCR with the primer sets specific for HPV and beta-glubin (β-globin) genes. The primers were previously described by Siddiqa et al.[17] Primers of β-globin were used as a control to eliminate the false results by checking the quality of DNA by amplifying the housekeeping gene. The primers – GP5+ and GP6+ were used to detect a large spectrum of genital HPV specific for L1 region. The target genes were amplified using Taq PCR Cora Kit (Qiagen, Germany). The reaction mixture of 25 μl contains 0.2 mM of dNTPs, 1.5 mM MgCl2, 0. 5 μM of reverse and forward primers, 1.25 U of taq DNA polymerase, 5 μl of taq DNA polymerase buffer, 250 ng of genomic DNA, and distilled water. The primers used to amplify β-glubin gene were forward primer – 5' ACACAACTGTGTTCACTAGC 3' and the reverse primer – 5' CAACTTCATCCACGTTCACC 3'. The primers used for the amplification of L1 region of HPV were forward primer – 5' TTTGTTACTGTGGTAGATACCAC3' and the reverse primer – 5' GAAAAATAAACTGCAAATCATATTC 3'. The PCR cycling parameters were composed of a 15 min initial denaturation at 94°C, followed by 40 amplification cycles of 1 min at 94°C, 2 min at 40°C, and 1 min at 72°C, and a final extension step at 72°C for 4 min. The PCR products were visualized on 1% agarose gel electrophoresis.

Ethical consideration

The study was approved by the Ethics Committee of Misurata Cancer Center, Libya. Written informed consents were obtained from patients before enrollment into the study.

  Results Top

The collected blocks of FFPE tissues of cervical tumors and control tissues were subjected to genomic DNA extraction. The quality of the extracted DNA samples was assessed, and the concentrations of DNA were determined. The genomic DNA samples were visualized by ethidium bromide-stained agarose gel electrophoresis to ensure the quality of DNA as shown in [Figure 1]. The gel demonstrated the integrity of the extracted genomic DNA and its intact structure without degradation. This extracted DNA was prepared for PCR analysis. The DNA samples were examined for the amplification of the housekeeping gene, β-glubin, using specific primers. The results of PCR reactions indicated the amplification of β-glubin fragment in the size of 110 bp as expected according to the primers' design. The DNA extracted from both benign and cancer cervical tissues have amplified the same fragment of β-glubin gene [Figure 2].
Figure 1: Genomic DNA extracted from cervical tissues. The DNA samples were visualized in 1% agarose gel electrophoresis and stained with ethidium bromide. Lanes 1–13 indicate the presence of genomic DNA samples

Click here to view
Figure 2: Amplification of beta-globin gene in DNA samples extracted from cervical tissues. The polymerase chain reaction products were subjected to ethidium bromide-stained agarose gel electrophoresis. Lane 1 indicates the DNA ladder, lane 2 indicates the DNA from cervical tissue from control sample, lanes 3–6 indicate the DNA from different cervical cancer tissues, and lane 7 indicates the polymerase chain reaction negative control (no template control)

Click here to view

The detection of HPV genes in cervical tissues from cancer patients and healthy women was carried using PCR technique. The designed forward and reverse primes (GP5 and GP6 respectively) code for L1 region of the virus. The two primers used in this experiment are amplified in the majority of HPV types. The results showed the amplification of the L1 gene at the size of 150 bp. Most of the cervical cancer tissues investigated in this study have shown the amplification of HPV gene indicating the presence of the virus. The HPV was found in tissues of 27 patients of cervical cancer tissues (71%). However, HPV gene was not detected in 11 patients diagnosed with cervical cancer (29%) as shown in [Figure 3].
Figure 3: Amplification of L1 gene of human papillomavirus in cervical cancer patients. Lane 1: DNA ladder, Lane 2: normal cervical tissue, Lane 3–13: cervical tumor samples, Lane 14: no template control

Click here to view

Our studied samples of tumor tissues were diagnosed and classified into different types of cervical cancer. We found the presence of HPV in squamous cell carcinoma (73%, 25/34), adenocarcinoma cases (33%, 1/3), and severe dysplasia samples (100%, 1/1). The detection of HPV virus in different types of the virus is shown in [Figure 4].
Figure 4: The distribution of human papillomavirus infection in cytological types of cervical cancer

Click here to view

The studied cervical tissues confirmed their staging and ranged mostly in Grade III (n = 23). HPV infection was found in 69.56% of Grade III cervical tumors (16/23). Cervical tumors from other grades also harbor HPV as shown in [Figure 5].
Figure 5: The distribution of human papillomavirus infection in different tumor grades of cervical cancer

Click here to view

We have looked into the infection of HPV in different age groups of the studied cervical cancer patients. The average age of cervical cancer patients subjected to our study was 51 years. The age group of 41–50 years showed the highest HPV infection according to the tested cases [Figure 6].
Figure 6: The distribution of human papillomavirus infection in age groups of cervical cancer patients

Click here to view

  Discussion and Conclusion Top

Diversity of HPV spectrum and its strong association with cervical cancer made it necessary to establish methods for the detection and identification of the various HPV genotypes not only for epidemiological investigations but also for patient management and selection of antiviral treatment and vaccines. There is an increasing interest in the use of nucleic acid amplification testing for HPV identification and typing.

Using PCR technique, we revealed that HPV is existing in 27 of the 38 cervical cancer patients (71%). The frequency of HPV infection in Libyan cervical cancer patients is similar to the countries in the Middle East and North Africa, which is estimated between 85% and 99%.[18],[19]

The difference of HPV infection in cervical cancer patients may be due to many factors such as detection methods, study size, age groups, or geographic and ethnic variations.[20] Our data showed that the infection with HPV occurred in different histological types and stages of cervical cancer which is supported by previous reports.[15],[21] In addition, HPV was investigated in different ages of cervical cancer patients. In this study, the age of 41–50 years demonstrated the highest in HPV occurrence among the studied group. Previous studies reported that HPV prevalence was high among women aged <30 years, followed by nonsignificant decline in HPV prevalence in women aged 30–50 years and an increase after 50 years of age. This was attributed to that the age <30 years presents the beginning of sexual activity and >50 years ages may be lack of viral clearance due to the insufficient adaptive immune response in this age.[13],[21]

We conclude that HPV infection is present in 71% of Libyan cervical cancer patients. PCR-based molecular technique provides a promising method to screen the virus. HPV was found in different types of cervical cancer tumors including squamous cell carcinoma and adenocarcinoma. In addition, the HPV was found mainly in tumors at Stage III (69%) and other stages of the disease. The age group of 41–50 years of patients showed the highest incidence of HPV. Detection of HPV is an important step for the national screening program of the virus in women at the adult and old ages. The prevalence of HPV in cervical cancer patients is an essential approach to estimate the cervical cancer rate and suggest the best strategies to eliminate the virus infection in women. Further studies with a large group of cervical cancer patients using DNA sequencing are needed to better assess the distribution of the high-risk HPV types.


We thank the medical staff at the pathology department in both Misurata Cancer Center and Tripoli Medical Center, especially Dr. Taha Bensaud and Dr. Fatima Maetig, for providing the cervical tissues and the medical reports. We appreciate the support from Mrs. Asma Alelish: Faculty of Science-Misurata University and Dr. Ali Ehwidi, Dr. Wafa Yousef, Wafa Ibrahem: Department of gynecology, Misurata Cancer Center, during the study. The funding of the research was provided by Biotechnology Research Center, Misurata, Libya. This manuscript has no conflict of interest with any company or other organization.

Financial support and sponsorship


Conflicts of interest

There are no conflicts of interest.

  References Top

Biryukov J, Meyers C. Papillomavirus infectious pathways: A comparison of systems. Viruses 2015;7:4303-25.  Back to cited text no. 1
Al Moustafa AE, Al-Awadhi R, Missaoui N, Adam I, Durusoy R, Ghabreau L, et al. Human papillomaviruses-related cancers. Presence and prevention strategies in the Middle East and North African regions. Hum Vaccin Immunother 2014;10:1812-21.  Back to cited text no. 2
Ahmed HG, Bensumaidea SH, Ashankyty IM. Frequency of human papilloma virus (HPV) subtypes 31,33,35,39 and 45 among Yemeni women with cervical cancer. Infect Agent Cancer 2015;10:29.  Back to cited text no. 3
Egawa N, Egawa K, Griffin H, Doorbar J. Human papillomaviruses; epithelial tropisms, and the development of neoplasia. Viruses 2015;7:3863-90.  Back to cited text no. 4
Adams AK, Wise-Draper TM, Wells SI. Human papillomavirus induced transformation in cervical and head and neck cancers. Cancers (Basel) 2014;6:1793-820.  Back to cited text no. 5
Xue J, Vesper J, Radosevich A. Human Papillomavirus: A Brief Averview, in HPV and Cancer. Netherlands: Springer; 2012. p. 1-15.  Back to cited text no. 6
David M, Chithra P, Mahesh R, Balakrishna S. Oral human papillomavirus infection. Insight 2017;3:1-9.  Back to cited text no. 7
Fields N, Mahan D, Howley M. Papillomaviruses, in Fields virology. Library of Congress Cataloging-in-Publication Date; 2013. p. 1662-703.  Back to cited text no. 8
Ruttkay-Nedecky B, Jimenez Jimenez AM, Nejdl L, Chudobova D, Gumulec J, Masarik M, et al. Relevance of infection with human papillomavirus: The role of the p53 tumor suppressor protein and E6/E7 zinc finger proteins (Review). Int J Oncol 2013;43:1754-62.  Back to cited text no. 9
Cubie HA. Diseases associated with human papillomavirus infection. Virology 2013;445:21-34.  Back to cited text no. 10
Wooden C, Collins S, Young L. The natural history of cervical HPV infection: unresolved issues. Nat Rev Cancer 2007;7:11-22.  Back to cited text no. 11
Xue J, Vesper J, Radosevich A. HPV and Cancer. Netherlands: Springer; 2012. p. 40-74.  Back to cited text no. 12
Alsbeih G, Al-Harbi N, El-Sebaie M, Al-Badawi I. HPV prevalence and genetic predisposition to cervical cancer in Saudi Arabia. Infect Agent Cancer 2013;8:15.  Back to cited text no. 13
Kisseljov FL. Virus-associated human tumors: Cervical carcinomas and papilloma viruses. Biochemistry (Mosc) 2000;65:68-77.  Back to cited text no. 14
Alsbeih G, Ahmed R, Al-Harbi N, Venturina LA, Tulbah A, Balaraj K, et al. Prevalence and genotypes' distribution of human papillomavirus in invasive cervical cancer in Saudi Arabia. Gynecol Oncol 2011;121:522-6.  Back to cited text no. 15
Goodman A. HPV testing as a screen for cervical cancer. BMJ 2015;350:h2372.  Back to cited text no. 16
Siddiqa A, Zainab M, Qadri I, Bhatti MF, Parish JL. Prevalence and genotyping of high risk human papillomavirus in cervical cancer samples from Punjab, Pakistan. Viruses 2014;6:2762-77.  Back to cited text no. 17
de Sanjose S, Quint WG, Alemany L, Geraets DT, Klaustermeier JE, Lloveras B. Human papillomavirus genotype attribution in invasive cervical cancer: A retrospective cross-sectional worldwide study. Lancet Oncol 2010;11:1048-56.  Back to cited text no. 18
Forman D, Martel C, Lacey C, Soerjomataram I, Lortet-Tienlent J, Bruni L, et al. Global burden of human papilloma virus and related diseases 2012;30:12-23.   Back to cited text no. 19
AlObaid A, Al-Badawi IA, Al-Kadri H, Gopala K, Kandeil W, Quint W, et al. Human papillomavirus prevalence and type distribution among women atten'ding routine gynecological examinations in Saudi Arabia. BMC Infect Dis 2014;14:643.  Back to cited text no. 20
Bruni L, Diaz M, Castellsagué X, Ferrer E, Bosch FX, de Sanjosé S, et al. Cervical human papillomavirus prevalence in 5 continents: Meta-analysis of 1 million women with normal cytological findings. J Infect Dis 2010;202:1789-99.  Back to cited text no. 21


  [Figure 1], [Figure 2], [Figure 3], [Figure 4], [Figure 5], [Figure 6]


Similar in PUBMED
   Search Pubmed for
   Search in Google Scholar for
 Related articles
Access Statistics
Email Alert *
Add to My List *
* Registration required (free)

  In this article
Materials and Me...
Discussion and C...
Article Figures

 Article Access Statistics
    PDF Downloaded165    
    Comments [Add]    

Recommend this journal
